AAV Synapsin Intron H2B Gcamp 6s wpre Pzac2.1
(Plasmid #74150)

• Purpose: calcium sensor
• Depositing Lab: Loren Looger
• Publication: 1. AAV Synapsin Intron H2B Gcamp 6f wpre Pzac2.1 (unpublished)

Backbone

• Vector backbone: AAV synapsin intron
• Backbone size w/o insert (bp): 4821
• Total vector size (bp): 6579
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: GCaMP6s
• Alt name: GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
• Species: R. norvegicus (rat), G. gallus (chicken); ; A. victoria (jellyfish)
• Insert Size (bp): 1353
• Promoter: Synapsin
• Tag / Fusion Protein:
  • H2B (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NruI (destroyed during cloning)
• 3′ cloning site: NruI (destroyed during cloning)
• 5′ sequencing primer: Intron f; gtatcaaggttacaagacag
• 3′ sequencing primer: AAV1621 r; gagttgtggcccgttgtcag

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Vector: AA0215 AAV Synapsin intron Pzac2.1 from Scott sternson lab hhmi/Jfrc.
Please note that the Addgene verified sequence was updated 2/25/22 due to an error in the original assembly. If you downloaded the sequence prior to this date, please note the transgene is in the opposite orientation.