-
PurposeFluorescent reporter for single ribosome tracking
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74172 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep323
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 9263
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameribosomal protein L10A
-
Alt namerpL10A
-
Alt nameL10A
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)651
-
Entrez GeneRpl10a
- Promoter UbC
-
Tag
/ Fusion Protein
- PATagRFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TGTACCTATCTTCTTAAGTA
- 3′ sequencing primer CAT AAA GAG ACA GCA ACC AG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p323-L10A-PATagRFP was a gift from Robert Singer (Addgene plasmid # 74172 ; http://n2t.net/addgene:74172 ; RRID:Addgene_74172) -
For your References section:
Mapping translation 'hot-spots' in live cells by tracking single molecules of mRNA and ribosomes. Katz ZB, English BP, Lionnet T, Yoon YJ, Monnier N, Ovryn B, Bathe M, Singer RH. Elife. 2016 Jan 13;5. pii: e10415. doi: 10.7554/eLife.10415. 10.7554/eLife.10415 PubMed 26760529