Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMXspuro-mCherry-NBR1
(Plasmid #74242)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74242 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMXs-puro
  • Backbone size w/o insert (bp) 6900
  • Total vector size (bp) 10500
  • Modifications to backbone
    Insert was digested with BglII/XhoI to ligate into the vector which was digested with BamHI/XhoI.
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    neighbor of BRCA1 gene 1
  • Alt name
    NBR1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2901
  • Entrez Gene
    NBR1 (a.k.a. 1A1-3B, IAI3B, M17S2, MIG19)
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GACGGCATCGCAGCTTGGATACAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mCherry-NBR1 was amplified and subsequently cloned from pDest-mCherry-NBR1 which was a gift from P. Kim (University of Toronto, Toronto, Ontario, Canada) and T. Johansen (University of Tromsø, Tromsø, Kirkin et al., 2009; Deosaran et al., 2013).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXspuro-mCherry-NBR1 was a gift from Jayanta Debnath (Addgene plasmid # 74242 ; http://n2t.net/addgene:74242 ; RRID:Addgene_74242)
  • For your References section:

    NBR1 enables autophagy-dependent focal adhesion turnover. Kenific CM, Stehbens SJ, Goldsmith J, Leidal AM, Faure N, Ye J, Wittmann T, Debnath J. J Cell Biol. 2016 Feb 29;212(5):577-590. Epub 2016 Feb 22. 10.1083/jcb.201503075 PubMed 26903539