-
PurposeExpresses RNF169 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74243 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA5-FRT/TO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5137
- Total vector size (bp) 7261
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRNF169
-
Alt nameRING Finger Protein 169
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2124
-
GenBank IDAB384343
-
Entrez GeneRNF169
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer gtgggagtggcaccttccag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5-FRT/TO-Flag-RNF169 was a gift from Daniel Durocher (Addgene plasmid # 74243 ; http://n2t.net/addgene:74243 ; RRID:Addgene_74243) -
For your References section:
Tandem protein interaction modules organize the ubiquitin-dependent response to DNA double-strand breaks. Panier S, Ichijima Y, Fradet-Turcotte A, Leung CC, Kaustov L, Arrowsmith CH, Durocher D. Mol Cell. 2012 Aug 10;47(3):383-95. doi: 10.1016/j.molcel.2012.05.045. Epub 2012 Jun 27. 10.1016/j.molcel.2012.05.045 PubMed 22742833