Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA5-FRT/TO-Flag-RNF169
(Plasmid #74243)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74243 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pcDNA5-FRT/TO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5137
  • Total vector size (bp) 7261
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RNF169
  • Alt name
    RING Finger Protein 169
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2124
  • GenBank ID
    AB384343
  • Entrez Gene
    RNF169
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer gtgggagtggcaccttccag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5-FRT/TO-Flag-RNF169 was a gift from Daniel Durocher (Addgene plasmid # 74243 ; http://n2t.net/addgene:74243 ; RRID:Addgene_74243)
  • For your References section:

    Tandem protein interaction modules organize the ubiquitin-dependent response to DNA double-strand breaks. Panier S, Ichijima Y, Fradet-Turcotte A, Leung CC, Kaustov L, Arrowsmith CH, Durocher D. Mol Cell. 2012 Aug 10;47(3):383-95. doi: 10.1016/j.molcel.2012.05.045. Epub 2012 Jun 27. 10.1016/j.molcel.2012.05.045 PubMed 22742833