pUC57-sgDedd-2
(Plasmid
#74436)
-
PurposesgRNA expression vector for mouse Dedd gene targeting intron 4
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74436 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC57-sgRNA expression vector
- Backbone size w/o insert (bp) 2800
- Total vector size (bp) 2820
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDedd
-
gRNA/shRNA sequencegtgcctcatgtaaaggtcag
-
SpeciesM. musculus (mouse)
-
GenBank IDMGI:1333874
-
Entrez GeneDedd (a.k.a. CASP8IP1, DEFT, Dedpro1, FLDED1, KE05)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC57-sgDedd-2 was a gift from Petra Arck (Addgene plasmid # 74436 ; http://n2t.net/addgene:74436 ; RRID:Addgene_74436)