Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEF-hSEMA4C-Fc
(Plasmid #74449)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74449 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEF-BOS
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 8696
  • Modifications to backbone
    The plasmid pEF-BOS-hSEMA4D-Fc (Kumanogoh et al., 2000) was modified by cutting out the Sema4D-ectodomain and inserting a SEMA4C ectodomain fragment.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Semaphorin-4C ectodomain with human Fc tag
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3261
  • GenBank ID
    NM_017789.4
  • Entrez Gene
    SEMA4C (a.k.a. M-SEMA-F, SEMACL1, SEMAF, SEMAI)
  • Promoter EF1-alpha
  • Tag / Fusion Protein
    • human Fc tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer EF-F CATTCTCAAGCCTCAGACAGTGGT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The hSEMA4C ectodomain fragment was amplified by PCR from the cDNA plasmid IMAGE #40035252

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF-hSEMA4C-Fc was a gift from Roland Friedel (Addgene plasmid # 74449 ; http://n2t.net/addgene:74449 ; RRID:Addgene_74449)
  • For your References section:

    Plexin-B2 promotes invasive growth of malignant glioma. Le AP, Huang Y, Pingle SC, Kesari S, Wang H, Yong RL, Zou H, Friedel RH. Oncotarget. 2015 Mar 30;6(9):7293-304. 10.18632/oncotarget.3421 PubMed 25762646