GFP-nArgBP2
(Plasmid
#74514)
-
PurposeExpress GFP-nArgBP2 fusion protein in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74514 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C2
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenArgBP2
-
Alt nameSorbs2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3774
-
GenBank IDKR610443.1
-
Entrez GeneSorbs2 (a.k.a. 2010203O03Rik, 9430041O17Rik, A530071H08, Argbp2, mKIAA0777, nArgBP2)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-nArgBP2 was a gift from Guoping Feng (Addgene plasmid # 74514 ; http://n2t.net/addgene:74514 ; RRID:Addgene_74514) -
For your References section:
Impaired Dendritic Development and Memory in Sorbs2 Knock-Out Mice. Zhang Q, Gao X, Li C, Feliciano C, Wang D, Zhou D, Mei Y, Monteiro P, Anand M, Itohara S, Dong X, Fu Z, Feng G. J Neurosci. 2016 Feb 17;36(7):2247-60. doi: 10.1523/JNEUROSCI.2528-15.2016. 10.1523/JNEUROSCI.2528-15.2016 PubMed 26888934