Skip to main content
Addgene

pKHR8
(Plasmid #74625)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74625 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKHR4
  • Backbone size w/o insert (bp) 3048
  • Vector type
    Cre/Lox ; Zebrafish Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    FRT-alpha-crystallin::Venus-FRT-loxP reporter cassette
  • Species
    D. rerio (zebrafish), Synthetic
  • Insert Size (bp)
    1853
  • Promoter alpha-crystallin

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer GTAAAACGACGGCCAGTGA
  • 3′ sequencing primer TGCTGATTTGGAGAGCTCATTT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    cmlc2::mCherry
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1836
  • Promoter cmlc2

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer CATCCTGCACTGAATGCACA
  • 3′ sequencing primer GGAAACAGCTATGACCATGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKHR8 was a gift from David Grunwald (Addgene plasmid # 74625 ; http://n2t.net/addgene:74625 ; RRID:Addgene_74625)
  • For your References section:

    Precise Editing of the Zebrafish Genome Made Simple and Efficient. Hoshijima K, Jurynec MJ, Grunwald DJ. Dev Cell. 2016 Mar 21;36(6):654-67. doi: 10.1016/j.devcel.2016.02.015. 10.1016/j.devcel.2016.02.015 PubMed 27003937