pGM48DEST
(Plasmid
#74757)
-
PurposeEncodes for the QS repressor gene, splice linker, and mCherry reporter gene
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUCTCAPR3-GW
- Total vector size (bp) 9565
-
Vector typeWorm Expression
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameQS
-
SpeciesNeurospora crassa
-
Insert Size (bp)2667
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer GGCGCGCCTCTAGAGGATCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGateway cassette
-
Insert Size (bp)1703
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGAAACAGCTATGACCATG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKang Shen Laboratory, Stanford University
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
bioRxiv doi.org/10.1101/445833
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGM48DEST was a gift from Jordan Ward & Keith Yamamoto (Addgene plasmid # 74757 ; http://n2t.net/addgene:74757 ; RRID:Addgene_74757) -
For your References section:
A New Tool for Inducible Gene Expression in Caenorhabditis elegans. Monsalve GC, Yamamoto KR, Ward JD. Genetics. 2019 Feb;211(2):419-430. doi: 10.1534/genetics.118.301705. Epub 2018 Nov 30. 10.1534/genetics.118.301705 PubMed 30504365