Skip to main content

pcDNA3-Flag::UbvG08 P69L, L70V, I44A, deltaGG
(Plasmid #74940)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74940 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcDNA3-Flag
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5470
  • Total vector size (bp) 5695
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ubiquitin
  • Alt name
    synthetic engineered ubiquitin variant UbvG08 (i53 DM mutant)
  • Alt name
    pcDNA3-Flag::i53-DM
  • Species
    Synthetic
  • Insert Size (bp)
    225
  • Mutation
    UbvG08 with I44A, P69L, and L70V mutations and no terminal Glycines
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer gtg gga gtg gca cct tcc ag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

bioRxiv (10.1101/060954)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-Flag::UbvG08 P69L, L70V, I44A, deltaGG was a gift from Daniel Durocher (Addgene plasmid # 74940 ; http://n2t.net/addgene:74940 ; RRID:Addgene_74940)
  • For your References section:

    Inhibition of 53BP1 favors homology-dependent DNA repair and increases CRISPR-Cas9 genome-editing efficiency. Canny MD, Moatti N, Wan LCK, Fradet-Turcotte A, Krasner D, Mateos-Gomez PA, Zimmermann M, Orthwein A, Juang YC, Zhang W, Noordermeer SM, Seclen E, Wilson MD, Vorobyov A, Munro M, Ernst A, Ng TF, Cho T, Cannon PM, Sidhu SS, Sicheri F, Durocher D. Nat Biotechnol. 2018 Jan;36(1):95-102. doi: 10.1038/nbt.4021. Epub 2017 Nov 27. 10.1038/nbt.4021 PubMed 29176614