FabF (KASII) pet28 N-terminal His Tag
(Plasmid
#75017)
-
PurposeExpresses the ketosynthase FabF/KASII from the E. coli fatty acid synthase
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 75017 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepet28
- Backbone size w/o insert (bp) 5369
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor protein expression, grow in BL21s at 37 degrees until OD of 0.8 reached (approximately 4-6 hours), induce with 0.5 mM IPTG, and grow at 16 degrees for 16 hours.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFabF
-
Alt nameKASII
-
SpeciesE. coli
-
Insert Size (bp)1302
-
GenBank ID946665 NC_000913.3
-
Entrez GenefabF (a.k.a. b1095, ECK1081, JW1081, cvc, fabJ, vtr)
- Promoter T7
-
Tag
/ Fusion Protein
- His Tag (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter, forward primer)
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (T7 terminator, reverse primer)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FabF (KASII) pet28 N-terminal His Tag was a gift from Michael Burkart (Addgene plasmid # 75017 ; http://n2t.net/addgene:75017 ; RRID:Addgene_75017) -
For your References section:
Mechanism-based protein cross-linking probes to investigate carrier protein-mediated biosynthesis. Worthington AS, Rivera H, Torpey JW, Alexander MD, Burkart MD. ACS Chem Biol. 2006 Dec 20;1(11):687-91. 10.1021/cb6003965 PubMed 17184132