Skip to main content

FabF (KASII) pet28 N-terminal His Tag
(Plasmid #75017)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75017 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pet28
  • Backbone size w/o insert (bp) 5369
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For protein expression, grow in BL21s at 37 degrees until OD of 0.8 reached (approximately 4-6 hours), induce with 0.5 mM IPTG, and grow at 16 degrees for 16 hours.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FabF
  • Alt name
    KASII
  • Species
    E. coli
  • Insert Size (bp)
    1302
  • GenBank ID
    946665 NC_000913.3
  • Entrez Gene
    fabF (a.k.a. b1095, ECK1081, JW1081, cvc, fabJ, vtr)
  • Promoter T7
  • Tag / Fusion Protein
    • His Tag (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter, forward primer)
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG (T7 terminator, reverse primer)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FabF (KASII) pet28 N-terminal His Tag was a gift from Michael Burkart (Addgene plasmid # 75017 ; http://n2t.net/addgene:75017 ; RRID:Addgene_75017)
  • For your References section:

    Mechanism-based protein cross-linking probes to investigate carrier protein-mediated biosynthesis. Worthington AS, Rivera H, Torpey JW, Alexander MD, Burkart MD. ACS Chem Biol. 2006 Dec 20;1(11):687-91. 10.1021/cb6003965 PubMed 17184132