pETDuet-msGC-NT13
(Plasmid
#75087)
-
Purposeexpresses the N-terminal fragment of manduca sexta soluble guanylyl cyclase subunits alpha and beta
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75087 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepETDuet-1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 7805
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namefragment of alfa subunit of sGC
-
Alt namealpha msGC
-
Speciesmanduca sexta (tobacco hornworm)
-
Insert Size (bp)1251
-
Mutationfragment 49-450 of the alfa subunit
-
GenBank IDAF062750
-
Tag
/ Fusion Protein
- His-tag (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCGTCCGGCGTAGA
- 3′ sequencing primer GATTATGCGGCCGTGTACAA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namefragment of beta subunit of sGC
-
Alt namebeta msGC
-
Speciesmanduca sexta (tobacco hornworm)
-
Insert Size (bp)1143
-
Mutationfragment 1-380 of the beta subunit
-
GenBank IDAF062751
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site EcorI (not destroyed)
- 5′ sequencing primer TTGTACACGGCCGCATAATC
- 3′ sequencing primer GCTAGTTATTGCTCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETDuet-msGC-NT13 was a gift from William Montfort (Addgene plasmid # 75087 ; http://n2t.net/addgene:75087 ; RRID:Addgene_75087) -
For your References section:
Molecular model of a soluble guanylyl cyclase fragment determined by small-angle X-ray scattering and chemical cross-linking. Fritz BG, Roberts SA, Ahmed A, Breci L, Li W, Weichsel A, Brailey JL, Wysocki VH, Tama F, Montfort WR. Biochemistry. 2013 Mar 5;52(9):1568-82. doi: 10.1021/bi301570m. Epub 2013 Feb 15. 10.1021/bi301570m PubMed 23363317