Skip to main content

pETDuet-msGC-NT13
(Plasmid #75087)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75087 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pETDuet-1
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5420
  • Total vector size (bp) 7805
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    fragment of alfa subunit of sGC
  • Alt name
    alpha msGC
  • Species
    manduca sexta (tobacco hornworm)
  • Insert Size (bp)
    1251
  • Mutation
    fragment 49-450 of the alfa subunit
  • GenBank ID
    AF062750
  • Tag / Fusion Protein
    • His-tag (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCGTCCGGCGTAGA
  • 3′ sequencing primer GATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    fragment of beta subunit of sGC
  • Alt name
    beta msGC
  • Species
    manduca sexta (tobacco hornworm)
  • Insert Size (bp)
    1143
  • Mutation
    fragment 1-380 of the beta subunit
  • GenBank ID
    AF062751

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site EcorI (not destroyed)
  • 5′ sequencing primer TTGTACACGGCCGCATAATC
  • 3′ sequencing primer GCTAGTTATTGCTCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETDuet-msGC-NT13 was a gift from William Montfort (Addgene plasmid # 75087 ; http://n2t.net/addgene:75087 ; RRID:Addgene_75087)
  • For your References section:

    Molecular model of a soluble guanylyl cyclase fragment determined by small-angle X-ray scattering and chemical cross-linking. Fritz BG, Roberts SA, Ahmed A, Breci L, Li W, Weichsel A, Brailey JL, Wysocki VH, Tama F, Montfort WR. Biochemistry. 2013 Mar 5;52(9):1568-82. doi: 10.1021/bi301570m. Epub 2013 Feb 15. 10.1021/bi301570m PubMed 23363317