pMSCV40-EF1a-hBCL10(1-114)-SO
(Plasmid
#75257)
-
Purposeretroviral expression vector for expression of StrepOne-Tagged human BCL10 (AS 1-116)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 75257 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCV-IRES-GFP (pMIG)
- Backbone size w/o insert (bp) 8400
- Total vector size (bp) 8812
-
Modifications to backboneAdded EF1a promoter prior to insert, added SV40-ori
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBcl10
-
Alt nameBCL-10, CIPER
-
Alt nameB-cell CLL/lymphoma 10
-
SpeciesH. sapiens (human)
-
Insert Size (bp)450
-
MutationAS 1-116 (CARD-domain)
-
GenBank ID8915 (gene-id) NM_003921.4
-
Entrez GeneBCL10 (a.k.a. CARMEN, CIPER, CLAP, IMD37, c-E10, mE10)
- Promoter pMSCV-LTRs, EF1a
-
Tag
/ Fusion Protein
- StrepOne Tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SwaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer AGCTTGATATCGAATTCCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
EF1a promoter ensures enhanced transgene transcription in some cells, but significantly reduces virus titer. This may result in less transduced cells, which produce high amounts of transgene, though, and can be sorted via GFP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV40-EF1a-hBCL10(1-114)-SO was a gift from Ria Baumgrass (Addgene plasmid # 75257 ; http://n2t.net/addgene:75257 ; RRID:Addgene_75257) -
For your References section:
Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. 10.1074/jbc.M116.739326 PubMed 27637333