Skip to main content

pMSCV40-EF1a-hBCL10(1-114)-SO
(Plasmid #75257)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75257 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMSCV-IRES-GFP (pMIG)
  • Backbone size w/o insert (bp) 8400
  • Total vector size (bp) 8812
  • Modifications to backbone
    Added EF1a promoter prior to insert, added SV40-ori
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Bcl10
  • Alt name
    BCL-10, CIPER
  • Alt name
    B-cell CLL/lymphoma 10
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    450
  • Mutation
    AS 1-116 (CARD-domain)
  • GenBank ID
    8915 (gene-id) NM_003921.4
  • Entrez Gene
    BCL10 (a.k.a. CARMEN, CIPER, CLAP, IMD37, c-E10, mE10)
  • Promoter pMSCV-LTRs, EF1a
  • Tag / Fusion Protein
    • StrepOne Tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SwaI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer AGCTTGATATCGAATTCCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

EF1a promoter ensures enhanced transgene transcription in some cells, but significantly reduces virus titer. This may result in less transduced cells, which produce high amounts of transgene, though, and can be sorted via GFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV40-EF1a-hBCL10(1-114)-SO was a gift from Ria Baumgrass (Addgene plasmid # 75257 ; http://n2t.net/addgene:75257 ; RRID:Addgene_75257)
  • For your References section:

    Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. 10.1074/jbc.M116.739326 PubMed 27637333