H2B-pDendra2(N)
(Plasmid
#75283)
-
PurposeExpresses H2B-Dendra2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75283 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDendra2-N
-
Backbone manufacturerEvrogen
- Backbone size w/o insert (bp) 4705
- Total vector size (bp) 5105
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2bk
-
Alt nameHIST1H2BK
-
SpeciesH. sapiens (human)
-
Insert Size (bp)378
-
GenBank IDNM_080593.2
-
Entrez GeneH2BC12 (a.k.a. H2B/S, H2BFAiii, H2BFT, H2BK, HIST1H2BK)
- Promoter CMV
-
Tag
/ Fusion Protein
- Dendra2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CMV Forward CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byXavier Darzacq
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
H2B-pDendra2(N) was a gift from Xavier Darzacq (Addgene plasmid # 75283 ; http://n2t.net/addgene:75283 ; RRID:Addgene_75283) -
For your References section:
Single cell correlation fractal dimension of chromatin: a framework to interpret 3D single molecule super-resolution. Recamier V, Izeddin I, Bosanac L, Dahan M, Proux F, Darzacq X. Nucleus. 2014 Jan-Feb;5(1):75-84. doi: 10.4161/nucl.28227. Epub 2014 Feb 19. 10.4161/nucl.28227 PubMed 24637833