-
PurposePCP-3XNeon-nls
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 75386 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHAGE-DEST
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 8740
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePCP
-
SpeciesSynthetic
-
Insert Size (bp)369
- Promoter EFS
-
Tag
/ Fusion Protein
- 3XmNeonGreen (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Mlu I (not destroyed)
- 3′ cloning site BamH I (not destroyed)
- 5′ sequencing primer cgaaggaatagaagaagaaggtgga
- 3′ sequencing primer CCAAAGGGAGATCCGACTCG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE-EFS-PCP-3XNeon-nls was a gift from Thoru Pederson (Addgene plasmid # 75386 ; http://n2t.net/addgene:75386 ; RRID:Addgene_75386) -
For your References section:
Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Ma H, Tu LC, Naseri A, Huisman M, Zhang S, Grunwald D, Pederson T. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. 10.1038/nbt.3526 PubMed 27088723