Skip to main content

pCMV-dCas9-mD3A
(Plasmid #78257)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78257 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV
  • Total vector size (bp) 14357
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DNMT3A CD aa 598-912
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    948
  • Mutation
    E756A
  • GenBank ID
    AF480163
  • Entrez Gene
    DNMT3A (a.k.a. DNMT3A2, HESJAS, M.HsaIIIA, TBRS)
  • Promoter pCMV
  • Tag / Fusion Protein
    • Flag epitope tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer ctgcagccttcaagtacttcgacacc
  • 3′ sequencing primer tacaaaggcattaaagcagcgta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-dCas9-mD3A was a gift from Grant Challen (Addgene plasmid # 78257 ; http://n2t.net/addgene:78257 ; RRID:Addgene_78257)
  • For your References section:

    Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. McDonald JI, Celik H, Rois LE, Fishberger G, Fowler T, Rees R, Kramer A, Martens A, Edwards JR, Challen GA. Biol Open. 2016 May 11. pii: bio.019067. doi: 10.1242/bio.019067. 10.1242/bio.019067 PubMed 27170255