pSpal2At
(Plasmid
#78286)
-
PurposeExpresses A. thaliana PAL2 in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78286 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSTV28
- Backbone size w/o insert (bp) 2999
- Total vector size (bp) 5127
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePAL2
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)2154
-
Mutation*see below
-
Entrez GenePAL2 (a.k.a. AT3G53260, ATPAL2, phenylalanine ammonia-lyase 2)
- Promoter lac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SphI (not destroyed)
- 5′ sequencing primer ctatgaccatgattacgaattc
- 3′ sequencing primer CCAGTGCCAAGCTTGCATGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
*Note: Addgene's quality control sequencing finds an E50A amino acid residue substitution in the A. thaliana PAL2 gene insert. The depositing laboratory does not believe this residue change will affect protein function. This plasmid accurately reflects the construct as it was used in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpal2At was a gift from David Nielsen (Addgene plasmid # 78286 ; http://n2t.net/addgene:78286 ; RRID:Addgene_78286) -
For your References section:
Styrene biosynthesis from glucose by engineered E. coli. McKenna R, Nielsen DR. Metab Eng. 2011 Sep;13(5):544-54. doi: 10.1016/j.ymben.2011.06.005. Epub 2011 Jun 23. 10.1016/j.ymben.2011.06.005 PubMed 21722749