Skip to main content

CAG-Cas9-T2A-EGFP-ires-puro
(Plasmid #78311)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78311 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PyCAG
  • Total vector size (bp) 11467
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    WT SpCas9-T2A-EGFP-ires-puromycin resistance
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    7118
  • Promoter CAG
  • Tag / Fusion Protein
    • T2A-EGFP-ires-puro (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site NsiI (unknown if destroyed)
  • 5′ sequencing primer pCAG-F GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer M13 Reverse CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cas9 expressing vector for genome editing of human pluripotent stem cells. Transfectants can be selected by EGFP+ sorting or transient treatment with puromycin. Described in Saarimäki-Vire, Balboa et al- 2016.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG-Cas9-T2A-EGFP-ires-puro was a gift from Timo Otonkoski (Addgene plasmid # 78311 ; http://n2t.net/addgene:78311 ; RRID:Addgene_78311)
  • For your References section:

    An Activating STAT3 Mutation Causes Neonatal Diabetes through Premature Induction of Pancreatic Differentiation. Saarimaki-Vire J, Balboa D, Russell MA, Saarikettu J, Kinnunen M, Keskitalo S, Malhi A, Valensisi C, Andrus C, Eurola S, Grym H, Ustinov J, Wartiovaara K, Hawkins RD, Silvennoinen O, Varjosalo M, Morgan NG, Otonkoski T. Cell Rep. 2017 Apr 11;19(2):281-294. doi: 10.1016/j.celrep.2017.03.055. 10.1016/j.celrep.2017.03.055 PubMed 28402852