Skip to main content
Addgene
Open Menu

CAG-Cas9-T2A-EGFP-ires-puro
(Plasmid #78311)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78311 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 78311-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 78311-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    PyCAG
  • Total vector size (bp) 11467
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    WT SpCas9-T2A-EGFP-ires-puromycin resistance
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    7118
  • Promoter CAG
  • Tag / Fusion Protein
    • T2A-EGFP-ires-puro (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site NsiI (unknown if destroyed)
  • 5′ sequencing primer pCAG-F GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer M13 Reverse CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PX330, Feng Zhang lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cas9 expressing vector for genome editing of human pluripotent stem cells. Transfectants can be selected by EGFP+ sorting or transient treatment with puromycin. Described in Saarimäki-Vire, Balboa et al- 2016.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG-Cas9-T2A-EGFP-ires-puro was a gift from Timo Otonkoski (Addgene plasmid # 78311 ; http://n2t.net/addgene:78311 ; RRID:Addgene_78311)

  • For your References section:

    An Activating STAT3 Mutation Causes Neonatal Diabetes through Premature Induction of Pancreatic Differentiation. Saarimaki-Vire J, Balboa D, Russell MA, Saarikettu J, Kinnunen M, Keskitalo S, Malhi A, Valensisi C, Andrus C, Eurola S, Grym H, Ustinov J, Wartiovaara K, Hawkins RD, Silvennoinen O, Varjosalo M, Morgan NG, Otonkoski T. Cell Rep. 2017 Apr 11;19(2):281-294. doi: 10.1016/j.celrep.2017.03.055. 10.1016/j.celrep.2017.03.055 PubMed 28402852
Related items:
Commonly requested with: