Skip to main content

pJEP206-AAV-1.3CaMKII-MCS-pA.
(Plasmid #78319)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78319 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV
  • Backbone manufacturer
    Agilent Technologies
  • Backbone size (bp) 4331
  • Modifications to backbone
    Vector backbone has 75 bps 3’UTR that contains an SV40 based poly-adenylation signal.
  • Vector type
    AAV
  • Promoter 1.3CaMKIIa

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer ccacgcgttcgtaacattatggccttaggtcacttcatctccatggggttc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJEP206-AAV-1.3CaMKII-MCS-pA. was a gift from Jonathan Ploski (Addgene plasmid # 78319 ; http://n2t.net/addgene:78319 ; RRID:Addgene_78319)
  • For your References section:

    The production of viral vectors designed to express large and difficult to express transgenes within neurons. Holehonnur R, Lella SK, Ho A, Luong JA, Ploski JE. Mol Brain. 2015 Feb 24;8:12. doi: 10.1186/s13041-015-0100-7. 10.1186/s13041-015-0100-7 PubMed 25887710