pJEP206-AAV-1.3CaMKII-MCS-pA.
(Plasmid
#78319)
-
Purpose(Empty Backbone) AAV vector backbone containing a 1.3CaMKIIa promoter followed by a multiple cloning site(MCS) followed by a poly-Adenylation Signal (pA)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78319 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV
-
Backbone manufacturerAgilent Technologies
- Backbone size (bp) 4331
-
Modifications to backboneVector backbone has 75 bps 3’UTR that contains an SV40 based poly-adenylation signal.
-
Vector typeAAV
- Promoter 1.3CaMKIIa
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ccacgcgttcgtaacattatggccttaggtcacttcatctccatggggttc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEP206-AAV-1.3CaMKII-MCS-pA. was a gift from Jonathan Ploski (Addgene plasmid # 78319 ; http://n2t.net/addgene:78319 ; RRID:Addgene_78319) -
For your References section:
The production of viral vectors designed to express large and difficult to express transgenes within neurons. Holehonnur R, Lella SK, Ho A, Luong JA, Ploski JE. Mol Brain. 2015 Feb 24;8:12. doi: 10.1186/s13041-015-0100-7. 10.1186/s13041-015-0100-7 PubMed 25887710