Skip to main content

hMYF5-3xHA-IRES-hrGFP (#397)
(Plasmid #78331)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78331 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIRES-2a-hrGFP
  • Backbone manufacturer
    Agilent Technologies
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 5800
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MYF5
  • Alt name
    Myogenic Factor 5
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    765
  • GenBank ID
    NM_005593.2
  • Entrez Gene
    MYF5 (a.k.a. EORVA, bHLHc2)
  • Promoter CMV
  • Tags / Fusion Proteins
    • 3x HA tag (C terminal on backbone)
    • IRES-hrGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer AATTAACCCTCACTAAAGGG
  • 3′ sequencing primer CTATTAAGCGTAGTCAGGTACATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please contact Dr. Alexander if you have any questions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hMYF5-3xHA-IRES-hrGFP (#397) was a gift from Matthew Alexander & Louis Kunkel (Addgene plasmid # 78331 ; http://n2t.net/addgene:78331 ; RRID:Addgene_78331)