Skip to main content

pEx1-pEF-H2B-mCherry-T2A-rTetR-KRAB-Zeo
(Plasmid #78352)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78352 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 78352-D50 50 μg of DNA in Tris buffer $495
DNA 78352-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pExchange1
  • Backbone manufacturer
    Agilent Technologies
  • Backbone size w/o insert (bp) 6591
  • Total vector size (bp) 8580
  • Modifications to backbone
    original CMV was replaced with pEF cut with BamHI and KpnI before Gibson inserted Zeo in the loxP site using Cre
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H2B-mCherry-T2A-rTetR-KRAB
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1989
  • GenBank ID
  • Promoter pEF alpha
  • Tag / Fusion Protein
    • rTetR (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer F1-factor: CTAAAGTGCGAAAGCGGCGG
  • 3′ sequencing primer T7 primer: TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    KRAB was PCR-amplified from PSV40-E-KRAB-pA (pWW43), a plasmid gifted by Martin Fussenegger rTetR was PCR-amplified from the rtTA3 system, Clontech

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEx1-pEF-H2B-mCherry-T2A-rTetR-KRAB-Zeo was a gift from Michael Elowitz (Addgene plasmid # 78352 ; http://n2t.net/addgene:78352 ; RRID:Addgene_78352)
  • For your References section:

    Dynamics of epigenetic regulation at the single-cell level. Bintu L, Yong J, Antebi YE, McCue K, Kazuki Y, Uno N, Oshimura M, Elowitz MB. Science. 2016 Feb 12;351(6274):720-4. doi: 10.1126/science.aab2956. 10.1126/science.aab2956 PubMed 26912859