pSJ111
(Plasmid
#78707)
-
PurposeModular vector for constitutive secreted amylase reporter expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78707 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRPF185
-
Backbone manufacturerFagan and Fairweather
- Backbone size w/o insert (bp) 6378
- Total vector size (bp) 8437
-
Modifications to backboneKpnI,SacI to remove Ptet, replaced with Pveg SacI, BamHI to remove gusA, replaced with amyEopt
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)MC1061
-
Growth instructionsFor selection in C. difficile, use thiamphenicol
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameamyEopt
-
Alt namesecreted alpha-amylase
-
SpeciesSynthetic
-
Insert Size (bp)1962
- Promoter Pveg
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer NF_793 (CACCTCCTTTTTGACTTTAAGCCTACGAATACC)
- 3′ sequencing primer NF_794 (CACCGACGAGCAAGGCAAGACCG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSJ111 was a gift from Wiep Klaas Smits (Addgene plasmid # 78707 ; http://n2t.net/addgene:78707 ; RRID:Addgene_78707) -
For your References section:
The Signal Sequence of the Abundant Extracellular Metalloprotease PPEP-1 Can Be Used to Secrete Synthetic Reporter Proteins in Clostridium difficile. Oliveira Paiva AM, Friggen AH, Hossein-Javaheri S, Smits WK. ACS Synth Biol. 2016 Jun 23. 10.1021/acssynbio.6b00104 PubMed 27333161