Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSJ111
(Plasmid #78707)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78707 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRPF185
  • Backbone manufacturer
    Fagan and Fairweather
  • Backbone size w/o insert (bp) 6378
  • Total vector size (bp) 8437
  • Modifications to backbone
    KpnI,SacI to remove Ptet, replaced with Pveg SacI, BamHI to remove gusA, replaced with amyEopt
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    MC1061
  • Growth instructions
    For selection in C. difficile, use thiamphenicol
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    amyEopt
  • Alt name
    secreted alpha-amylase
  • Species
    Synthetic
  • Insert Size (bp)
    1962
  • Promoter Pveg

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer NF_793 (CACCTCCTTTTTGACTTTAAGCCTACGAATACC)
  • 3′ sequencing primer NF_794 (CACCGACGAGCAAGGCAAGACCG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSJ111 was a gift from Wiep Klaas Smits (Addgene plasmid # 78707 ; http://n2t.net/addgene:78707 ; RRID:Addgene_78707)
  • For your References section:

    The Signal Sequence of the Abundant Extracellular Metalloprotease PPEP-1 Can Be Used to Secrete Synthetic Reporter Proteins in Clostridium difficile. Oliveira Paiva AM, Friggen AH, Hossein-Javaheri S, Smits WK. ACS Synth Biol. 2016 Jun 23. 10.1021/acssynbio.6b00104 PubMed 27333161