Skip to main content
Addgene

pCAG-eCas9-GFP-U6-gRNA
(Plasmid #79145)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79145 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    eSpCas9(1.1)
  • Backbone manufacturer
    Addgene #71814
  • Total vector size (bp) 10243
  • Modifications to backbone
    Added 2A-GFP to the C-terminal of eSpCas9(1.1) and replaced CBh promoter with CAG promoter
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eSpCas9(1.1)
  • Promoter CAG
  • Tag / Fusion Protein
    • 2A-GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (not destroyed)
  • 3′ cloning site BbsI (not destroyed)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was modified from Addgene plasmid #71814 and contains GFP cassette.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-eCas9-GFP-U6-gRNA was a gift from Jizhong Zou (Addgene plasmid # 79145 ; http://n2t.net/addgene:79145 ; RRID:Addgene_79145)