pET31b-T7-Spinach2-Pl-B
(Plasmid
#79161)
-
PurposeExpresses the Pl-B biosensor under a T7 promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79161 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET31b+
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5700
- Total vector size (bp) 5575
-
Modifications to backboneInserted at BglII/XhoI
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameT7-tRNA-Spinach2-Pl-B
-
Insert Size (bp)162
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCTTAATGCGCCGCTACAG
- 3′ sequencing primer CCGGCGTAGAGGATCGAGATCT
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET31b-T7-Spinach2-Pl-B was a gift from Ming Hammond (Addgene plasmid # 79161 ; http://n2t.net/addgene:79161 ; RRID:Addgene_79161) -
For your References section:
Next-generation RNA-based fluorescent biosensors enable anaerobic detection of cyclic di-GMP. Wang XC, Wilson SC, Hammond MC. Nucleic Acids Res. 2016 Jul 5. pii: gkw580. 10.1093/nar/gkw580 PubMed 27382070