pCOLA-T7-WspR
(Plasmid
#79162)
-
PurposeExpresses WspR WT under a T7 promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79162 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCOLADuet
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 3719
- Total vector size (bp) 4709
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameWspR
-
SpeciesP. areuginosa
-
Insert Size (bp)1041
-
GenBank IDNC_002516.2
-
Entrez GenewspR (a.k.a. PA3702)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ttgtacacggccgcataatc
- 3′ sequencing primer gctagttattgctcagcgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCOLA-T7-WspR was a gift from Ming Hammond (Addgene plasmid # 79162 ; http://n2t.net/addgene:79162 ; RRID:Addgene_79162) -
For your References section:
Next-generation RNA-based fluorescent biosensors enable anaerobic detection of cyclic di-GMP. Wang XC, Wilson SC, Hammond MC. Nucleic Acids Res. 2016 Jul 5. pii: gkw580. 10.1093/nar/gkw580 PubMed 27382070