-
PurposeExpression of mouse Cebpa
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepScalps
- Backbone size w/o insert (bp) 7740
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCebp alpha
-
Alt nameCCAAT/Enhancer Binding Protein (C/EBP), alpha
-
Alt nameC/EBP alpha
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1080
-
Entrez GeneCebpa (a.k.a. C/ebpalpha, CBF-A, Cebp)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GCTTCTCGCTTCTGTTCG
- 3′ sequencing primer GTTGTCAAGCGATGAGGCGCGT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pScalps_Puro_mCebpa was a gift from Silvia Monticelli (Addgene plasmid # 79551 ; http://n2t.net/addgene:79551 ; RRID:Addgene_79551) -
For your References section:
TET2 Regulates Mast Cell Differentiation and Proliferation through Catalytic and Non-catalytic Activities. Montagner S, Leoni C, Emming S, Della Chiara G, Balestrieri C, Barozzi I, Piccolo V, Togher S, Ko M, Rao A, Natoli G, Monticelli S. Cell Rep. 2016 May 17;15(7):1566-79. doi: 10.1016/j.celrep.2016.04.044. Epub 2016 May 5. 10.1016/j.celrep.2016.04.044 PubMed 27160912