Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #79614)


Item Catalog # Description Quantity Price (USD)
Plasmid 79614 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 12088
  • Modifications to backbone
    EcoRI site is mutated in Leu2
  • Vector type
    Yeast Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Species
    Streptococcus pyogenes
  • Mutation
    D10A and H840A for nuclease deficient Cas9
  • Promoter pGal1
  • Tag / Fusion Protein
    • SH3 domain (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tagcatctatgcgacacgg
  • 3′ sequencing primer gtaaaacgacggccagt
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Promoter pGal10
  • Tag / Fusion Protein
    • SHL (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer caggaaacagctatgac
  • 3′ sequencing primer gctctttacatttccacaac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This is derived from Addgene plasmid ID43804.
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS315e_pGal-dCas9-SH3-pGal-PmCDA1-SHL was a gift from Akihiko Kondo (Addgene plasmid # 79614 ; ; RRID:Addgene_79614)
  • For your References section:

    Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Nishida K, Arazoe T, Yachie N, Banno S, Kakimoto M, Tabata M, Mochizuki M, Miyabe A, Araki M, Hara KY, Shimatani Z, Kondo A. Science. 2016 Aug 4. pii: aaf8729. 10.1126/science.aaf8729 PubMed 27492474