Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pBAV150
(Plasmid #79764)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79764 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Binary vector pTA7001
  • Modifications to backbone
    combination of pTA7001 with EGFP
  • Vector type
    Plant Expression ; TetR
  • Promoter DEX
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GCAATAATGGTTTCTGACGTATG
  • 3′ sequencing primer CCCAGTCACGACGTTGTAAAACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Boris Vinatzer, Jean Greenberg

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAV150 was a gift from Nico Dissmeyer & Jean Greenberg (Addgene plasmid # 79764 ; http://n2t.net/addgene:79764 ; RRID:Addgene_79764)
  • For your References section:

    The type III effector repertoire of Pseudomonas syringae pv. syringae B728a and its role in survival and disease on host and non-host plants. Vinatzer BA, Teitzel GM, Lee MW, Jelenska J, Hotton S, Fairfax K, Jenrette J, Greenberg JT. Mol Microbiol. 2006 Oct;62(1):26-44. Epub 2006 Aug 30. 10.1111/j.1365-2958.2006.05350.x PubMed 16942603