pLLX13
(Plasmid
#79825)
-
Purpose(Empty Backbone) Yeast and Bacterial shuttle vector, includes origin of transfer for conjugation, used for making a DNA capture vector
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79825 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLLX13
- Backbone size (bp) 9977
-
Vector typeYeast and bacteria shuttle vector, contains origin of transfer for conjugation, can be used as backbone for a capture vector
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- 5′ sequencing primer GGCCGAAATCGGCAAGGATC
- 3′ sequencing primer TTTATCACTGATAAGTTGGTGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPlasmid is from Dr. Stephen Lory's laboratory in the Microbiology and Immunobiology Department at Harvard Medical School.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Additional reference: Reeves AZ, Spears WE, Du J, Tan KY, Wagers AJ, Lesser CF. (2015) Engineering Escherichia coli into a protein delivery system for mammalian cells. ACS Synthetic Biology, 2015, May 15;4(5):644-54
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLLX13 was a gift from Cammie Lesser & Stephen Lory (Addgene plasmid # 79825 ; http://n2t.net/addgene:79825 ; RRID:Addgene_79825) -
For your References section:
Conservation of genome content and virulence determinants among clinical and environmental isolates of Pseudomonas aeruginosa. Wolfgang MC, Kulasekara BR, Liang X, Boyd D, Wu K, Yang Q, Miyada CG, Lory S. Proc Natl Acad Sci U S A. 2003 Jul 8;100(14):8484-9. Epub 2003 Jun 18. 10.1073/pnas.0832438100 PubMed 12815109