WasCFP /pQE-30
(Plasmid
#79858)
-
PurposeCyan-green fluorescent protein with tryptophan-based chromophore in equilibrium between anionic and neutral states.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79858 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQE-30
-
Backbone manufacturerQIAGEN
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 4250
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameWasCFP
-
Alt nameWasCFP
-
SpeciesSynthetic
-
Insert Size (bp)750
-
MutationCyan fluorescent protein mCerulean with substitutions V61K, D148G, Y151N and L207Q.
-
GenBank IDKX377671 KX377671
- Promoter T5 promoter / lac operator
-
Tag
/ Fusion Protein
- HisTag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATTGTGAGCGGATAACAATTTC
- 3′ sequencing primer CCGAGCGTTCTGAACAAATC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
WasCFP /pQE-30 was a gift from Konstantin Lukyanov (Addgene plasmid # 79858 ; http://n2t.net/addgene:79858 ; RRID:Addgene_79858) -
For your References section:
Tryptophan-based chromophore in fluorescent proteins can be anionic. Sarkisyan KS, Yampolsky IV, Solntsev KM, Lukyanov SA, Lukyanov KA, Mishin AS. Sci Rep. 2012;2:608. doi: 10.1038/srep00608. Epub 2012 Aug 29. 10.1038/srep00608 PubMed 22934131