pRS416gT-GalL-Cas9
(Plasmid
#79903)
-
PurposepRS416 (URA) + RPR1(TetO) promoter with gRNA locus + Tetracycline Repressor + GalL promoter driven Cas9 for yeast expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79903 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS416
- Backbone size w/o insert (bp) 4898
- Total vector size (bp) 12421
-
Vector typeYeast Expression, CRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCas9
-
SpeciesSynthetic
- Promoter GalL
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GACGCCACACTGATTCATCAG
- 3′ sequencing primer TGCTCGGCACCTTGTACTCG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameguide RNA (gRNA)
-
SpeciesSynthetic
- Promoter RPR1 promoter with TetO site
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTCGTGCACACAGCCC
- 3′ sequencing primer agtttggcgaacacttcacc
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameTetracycline Repressor
-
Alt nameTetR
-
Insert Size (bp)624
- Promoter GPM1 promoter
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer gagtacaaacgcatgaaatcc
- 3′ sequencing primer CGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGalL Cas9 was obtained from: https://www.addgene.org/43804/
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For a nice map of all the features on this plasmid check out this benchling map: https://benchling.com/s/28w2TI93/edit
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS416gT-GalL-Cas9 was a gift from Ronald Davis (Addgene plasmid # 79903 ; http://n2t.net/addgene:79903 ; RRID:Addgene_79903) -
For your References section:
Distinct patterns of Cas9 mismatch tolerance in vitro and in vivo. Fu BX, St Onge RP, Fire AZ, Smith JD. Nucleic Acids Res. 2016 May 19. pii: gkw417. 10.1093/nar/gkw417 PubMed 27198218