-
PurposeTM-MAGE strain
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79968 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD24
- Backbone size w/o insert (bp) 4542
- Total vector size (bp) 7337
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameLambda Red recombinase beta subunit
-
Alt namebeta
-
SpeciesEscherichia coli (EcNR1)
-
GenBank ID
- Promoter pBAD
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GTAACAAAGCGGGACCAAAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameDNA adenine methylase
-
Alt namedam
-
SpeciesEscherichia coli K-12 MG1655
-
GenBank ID
- Promoter pBAD
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ACGACTTATTGCCGCTCTGT
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameLevansucrase
-
Alt namesacB
-
SpeciesEscherichia coli (DA16543)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer TACTTTGGCGTCACCCCTTA
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMA7-SacB was a gift from Morten Sommer (Addgene plasmid # 79968 ; http://n2t.net/addgene:79968 ; RRID:Addgene_79968) -
For your References section:
Transient overexpression of DNA adenine methylase enables efficient and mobile genome engineering with reduced off-target effects. Lennen RM, Nilsson Wallin AI, Pedersen M, Bonde M, Luo H, Herrgard MJ, Sommer MO. Nucleic Acids Res. 2016 Feb 29;44(4):e36. doi: 10.1093/nar/gkv1090. Epub 2015 Oct 22. 10.1093/nar/gkv1090 PubMed 26496947