Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHAGE-RSV-GCaMP6s
(Plasmid #80146)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80146 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHAGE
  • Backbone manufacturer
    Richard Mulligan
  • Total vector size (bp) 7459
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GCaMP6s
  • Species
    Synthetic
  • Insert Size (bp)
    1353
  • Promoter RSV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ggtacagtgcaggggaaagaat
  • 3′ sequencing primer gctattgcttcccgtatggctttc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE-RSV-GCaMP6s was a gift from Darrell Kotton (Addgene plasmid # 80146 ; http://n2t.net/addgene:80146 ; RRID:Addgene_80146)
  • For your References section:

    Unstable neurons underlie a stable learned behavior. Liberti WA 3rd, Markowitz JE, Perkins LN, Liberti DC, Leman DP, Guitchounts G, Velho T, Kotton DN, Lois C, Gardner TJ. Nat Neurosci. 2016 Oct 10. doi: 10.1038/nn.4405. 10.1038/nn.4405 PubMed 27723744