-
PurposeFluorescent reporter for calcium signaling
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80316 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHAGE
-
Backbone manufacturerRichard Mulligan
- Total vector size (bp) 8953
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nametdTomato
-
Insert Size (bp)1428
- Promoter RSV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer ggtacagtgcaggggaaagaat
- 3′ sequencing primer CGTGATGAGTCGACCATGGT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGCaMP6s
-
SpeciesSynthetic
-
Insert Size (bp)1353
- Promoter RSV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer tgttcctgtacggcatggacga
- 3′ sequencing primer gctattgcttcccgtatggctttc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE-RSV-tdTomato-2A-GCaMP6s was a gift from Darrell Kotton (Addgene plasmid # 80316 ; http://n2t.net/addgene:80316 ; RRID:Addgene_80316) -
For your References section:
Unstable neurons underlie a stable learned behavior. Liberti WA 3rd, Markowitz JE, Perkins LN, Liberti DC, Leman DP, Guitchounts G, Velho T, Kotton DN, Lois C, Gardner TJ. Nat Neurosci. 2016 Oct 10. doi: 10.1038/nn.4405. 10.1038/nn.4405 PubMed 27723744