Skip to main content
Addgene

Banshee Runx1FL mCherry
(Plasmid #80157)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80157 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Banshee
  • Backbone manufacturer
    Dr. John Rossi, Beckman Research Institute of the City of Hope, CA
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Runx1
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Runx1 (a.k.a. AML1, CBF-alpha-2, Cbfa2, Pebp2a2, Pebpa2b)
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • IRES-mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GCCCTTTGTACACCCTAAGCCT
  • 3′ sequencing primer mCherry-R or TCAAGAAGACAGGGCCAGGTTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Banshee Runx1FL mCherry was a gift from Ellen Rothenberg (Addgene plasmid # 80157 ; http://n2t.net/addgene:80157 ; RRID:Addgene_80157)