Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Banshee Runx1FL mCherry
(Plasmid #80157)


Item Catalog # Description Quantity Price (USD)
Plasmid 80157 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Dr. John Rossi, Beckman Research Institute of the City of Hope, CA
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Runx1 (a.k.a. AM, AML1, CBF-alpha-2, Cbfa, Cbfa2, Pebp, Pebp2a2, Pebpa2b)
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • IRES-mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GCCCTTTGTACACCCTAAGCCT
  • 3′ sequencing primer mCherry-R or TCAAGAAGACAGGGCCAGGTTT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Banshee Runx1FL mCherry was a gift from Ellen Rothenberg (Addgene plasmid # 80157 ; ; RRID:Addgene_80157)