pU6-SAG1-DHFR
(Plasmid
#80322)
-
PurposeEncodes a CRISPR sgRNA that allows for mutation of the surface antigen SAG1 in Toxoplasma gondii and confers resistance to pyrimethamine
-
Depositing Lab
-
Depositing OrganizationWhitehead Institute for Biomedical Research
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80322 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 80322-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 80322-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepU6-DHFR
- Backbone size w/o insert (bp) 6272
-
Modifications to backboneAn sgRNA targeting SAG1 has been cloned into the BsaI sites
-
Vector typeCRISPR
-
Selectable markersDHFR-TSc3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSAG1 sgRNA
-
gRNA/shRNA sequenceGGCAGTGAGACGCGCCGTCA
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer cacctctgacttgagcgtcg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 80322-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 80322-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-SAG1-DHFR was a gift from Sebastian Lourido (Addgene plasmid # 80322 ; http://n2t.net/addgene:80322 ; RRID:Addgene_80322) -
For your References section:
A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Sidik SM, Huet D, Ganesan SM, Huynh MH, Wang T, Nasamu AS, Thiru P, Saeij JP, Carruthers VB, Niles JC, Lourido S. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2. 10.1016/j.cell.2016.08.019 PubMed 27594426