pDrVSP-IRES2-EGFP
(Plasmid #80333)

• Purpose: Expresses Danio rerio VSP with separated EGFP in mammalian cell
• Depositing Lab: Yasushi Okamura
• Publication: Hossain et al J Biol Chem. 2008 Jun 27;283(26):18248-59. doi: 10.1074/jbc.M706184200. Epub 2008 Mar 28.

Backbone

• Vector backbone: pIRES2-EGFP
• Backbone manufacturer: Clonetech
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Daino rerio voltage-sensing phosphatase
• Alt name: Dr-VSP
• Species: D. rerio (zebrafish)
• Insert Size (bp): 1536
• GenBank ID: AB308476
• Entrez Gene: tpte (a.k.a. tpip, vsp, wu:fd20e11, wu:fi24b06)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (destroyed during cloning)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: GCAGAGCTGGTTTAGTGAACCG

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry