Skip to main content
Addgene

pAAV2.5-THP-dsRed2
(Plasmid #80335)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80335 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV2.5
  • Backbone size w/o insert (bp) 4244
  • Total vector size (bp) 6744
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    rat TH promoter
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2500
  • GenBank ID
  • Entrez Gene
    Th (a.k.a. The)
  • Promoter rat Tyrosine hydroxylase

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sfi I (destroyed during cloning)
  • 3′ cloning site Alu I (not destroyed)
  • 5′ sequencing primer GAGTGGCCAACTCCATCACT
  • 3′ sequencing primer GAGTTCATGCGCTTCAAGGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV2.5-THP-dsRed2 was a gift from Kwang-Soo Kim (Addgene plasmid # 80335 ; http://n2t.net/addgene:80335 ; RRID:Addgene_80335)
  • For your References section:

    Expression of transgenes in midbrain dopamine neurons using the tyrosine hydroxylase promoter. Oh MS, Hong SJ, Huh Y, Kim KS. Gene Ther. 2009 Mar;16(3):437-40. doi: 10.1038/gt.2008.148. Epub 2008 Sep 18. 10.1038/gt.2008.148 PubMed 18800154