Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV2.5-THP-dsRed2
(Plasmid #80335)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80335 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV2.5
  • Backbone size w/o insert (bp) 4244
  • Total vector size (bp) 6744
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    rat TH promoter
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2500
  • GenBank ID
    AF014956
  • Entrez Gene
    Th (a.k.a. The)
  • Promoter rat Tyrosine hydroxylase

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sfi I (destroyed during cloning)
  • 3′ cloning site Alu I (not destroyed)
  • 5′ sequencing primer GAGTGGCCAACTCCATCACT
  • 3′ sequencing primer GAGTTCATGCGCTTCAAGGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV2.5-THP-dsRed2 was a gift from Kwang-Soo Kim (Addgene plasmid # 80335 ; http://n2t.net/addgene:80335 ; RRID:Addgene_80335)
  • For your References section:

    Expression of transgenes in midbrain dopamine neurons using the tyrosine hydroxylase promoter. Oh MS, Hong SJ, Huh Y, Kim KS. Gene Ther. 2009 Mar;16(3):437-40. doi: 10.1038/gt.2008.148. Epub 2008 Sep 18. 10.1038/gt.2008.148 PubMed 18800154