-
PurposeFluorescent Reporter for Dopaminergic Neuron Differentiation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80336 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV2.5
- Backbone size w/o insert (bp) 4245
- Total vector size (bp) 6745
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namerat TH promoter
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2500
-
GenBank IDAF014956
-
Entrez GeneTh (a.k.a. The)
- Promoter rat Tyrosine hydroxylase
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sfi I (destroyed during cloning)
- 3′ cloning site Alu I (not destroyed)
- 5′ sequencing primer GAGTGGCCAACTCCATCACT
- 3′ sequencing primer GAGTTCATGCGCTTCAAGGT
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV2.5-THP-GFP was a gift from Kwang-Soo Kim (Addgene plasmid # 80336 ; http://n2t.net/addgene:80336 ; RRID:Addgene_80336) -
For your References section:
Expression of transgenes in midbrain dopamine neurons using the tyrosine hydroxylase promoter. Oh MS, Hong SJ, Huh Y, Kim KS. Gene Ther. 2009 Mar;16(3):437-40. doi: 10.1038/gt.2008.148. Epub 2008 Sep 18. 10.1038/gt.2008.148 PubMed 18800154