pSKA413
(Plasmid
#80381)
-
PurposeConstitutive CcaS and CcaR with gfpmut3 under the cpcG2Δ59 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80381 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepZE31
-
Backbone manufacturerLutz and Bujard. 1997. Nucleic Acids Research, 25: 1203-1210.
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 5859
-
Vector typeBacterial Expression, Synthetic Biology ; Optogenetics
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameccaS (complement)
-
Alt namegreen-light sensing histidine kinase
-
SpeciesSynechocystis sp. PCC6803
-
Insert Size (bp)2259
- Promoter ccaR
-
Tag
/ Fusion Protein
- FLAG tag (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTGTGCAACGTGCCAAC
- 3′ sequencing primer GTGAAAGTTGGAACCTCTTACG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameccaR (complement)
-
Alt nameresponse regulator
-
SpeciesSynechocystis sp. PCC6803
-
Insert Size (bp)702
- Promoter ccaR
-
Tag
/ Fusion Protein
- FLAG tag (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGAAAAGTTCTTCTCCTTTACGC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namegfpmut3
-
Alt namegreen fluorescent variant
-
SpeciesA. victoria
-
Insert Size (bp)717
- Promoter cpcG2Δ59
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCAATATCAACGGTGTAAAGC
- 3′ sequencing primer CTTTGAGTGAGCTGATACCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSKA413 was a gift from Mustafa Khammash (Addgene plasmid # 80381 ; http://n2t.net/addgene:80381 ; RRID:Addgene_80381) -
For your References section:
Automated optogenetic feedback control for precise and robust regulation of gene expression and cell growth. Milias-Argeitis A, Rullan M, Aoki SK, Buchmann P, Khammash M. Nat Commun. 2016 Aug 26;7:12546. doi: 10.1038/ncomms12546. 10.1038/ncomms12546 PubMed 27562138