Skip to main content

pCMV6-Neo-ISG15-LRAA
(Plasmid #80405)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80405 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV6-Neo
  • Backbone manufacturer
    Origene
  • Backbone size w/o insert (bp) 5835
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ISG15
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    685
  • Mutation
    nonconjugative ISG15, LRAA
  • GenBank ID
    NM_005101.3
  • Entrez Gene
    ISG15 (a.k.a. G1P2, IFI15, IMD38, IP17, UCRP, hUCRP)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer hGH-PA-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Synthesis of the nonconjugative ISG15 plasmid pCMV6-Neo-ISG15-LRAA from pCMV6-Neo-ISG15 (Addgene plasmid 80404) was performed by directed mutagenesis using the Phusion site-directed mutagenesis kit (Thermo Scientific), following the manufacturer′s instructions, with the following primers: forward, (5′CCTGCGGGCAGCCGGCACAGAGCCTGGCGGGCGGAGC3′), and reverse, (5′GGCTGCCCGCAGGCGCAGATTCATGAACACGGT3′).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV6-Neo-ISG15-LRAA was a gift from Isidoro Martinez (Addgene plasmid # 80405 ; http://n2t.net/addgene:80405 ; RRID:Addgene_80405)
  • For your References section:

    ISG15 Is Upregulated in Respiratory Syncytial Virus Infection and Reduces Virus Growth through Protein ISGylation. Gonzalez-Sanz R, Mata M, Bermejo-Martin J, Alvarez A, Cortijo J, Melero JA, Martinez I. J Virol. 2016 Jan 13;90(7):3428-38. doi: 10.1128/JVI.02695-15. 10.1128/JVI.02695-15 PubMed 26763998