Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV6-Neo-ISG15-LRAA
(Plasmid #80405)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80405 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV6-Neo
  • Backbone manufacturer
    Origene
  • Backbone size w/o insert (bp) 5835
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ISG15
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    685
  • Mutation
    nonconjugative ISG15, LRAA
  • GenBank ID
    NM_005101.3
  • Entrez Gene
    ISG15 (a.k.a. G1P2, IFI15, IMD38, IP17, UCRP, hUCRP)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer hGH-PA-R
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Synthesis of the nonconjugative ISG15 plasmid pCMV6-Neo-ISG15-LRAA from pCMV6-Neo-ISG15 (Addgene plasmid 80404) was performed by directed mutagenesis using the Phusion site-directed mutagenesis kit (Thermo Scientific), following the manufacturer′s instructions, with the following primers: forward, (5′CCTGCGGGCAGCCGGCACAGAGCCTGGCGGGCGGAGC3′), and reverse, (5′GGCTGCCCGCAGGCGCAGATTCATGAACACGGT3′).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV6-Neo-ISG15-LRAA was a gift from Isidoro Martinez (Addgene plasmid # 80405 ; http://n2t.net/addgene:80405 ; RRID:Addgene_80405)
  • For your References section:

    ISG15 Is Upregulated in Respiratory Syncytial Virus Infection and Reduces Virus Growth through Protein ISGylation. Gonzalez-Sanz R, Mata M, Bermejo-Martin J, Alvarez A, Cortijo J, Melero JA, Martinez I. J Virol. 2016 Jan 13;90(7):3428-38. doi: 10.1128/JVI.02695-15. 10.1128/JVI.02695-15 PubMed 26763998