pCMV6-Neo-ISG15-LRAA
(Plasmid
#80405)
-
Purposeoverexpression of nonconjugative ISG15
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80405 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV6-Neo
-
Backbone manufacturerOrigene
- Backbone size w/o insert (bp) 5835
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameISG15
-
SpeciesH. sapiens (human)
-
Insert Size (bp)685
-
Mutationnonconjugative ISG15, LRAA
-
GenBank IDNM_005101.3
-
Entrez GeneISG15 (a.k.a. G1P2, IFI15, IMD38, IP17, UCRP, hUCRP)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer hGH-PA-R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Synthesis of the nonconjugative ISG15 plasmid pCMV6-Neo-ISG15-LRAA from pCMV6-Neo-ISG15 (Addgene plasmid 80404) was performed by directed mutagenesis using the Phusion site-directed mutagenesis kit (Thermo Scientific), following the manufacturer′s instructions, with the following primers: forward, (5′CCTGCGGGCAGCCGGCACAGAGCCTGGCGGGCGGAGC3′), and reverse, (5′GGCTGCCCGCAGGCGCAGATTCATGAACACGGT3′).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV6-Neo-ISG15-LRAA was a gift from Isidoro Martinez (Addgene plasmid # 80405 ; http://n2t.net/addgene:80405 ; RRID:Addgene_80405) -
For your References section:
ISG15 Is Upregulated in Respiratory Syncytial Virus Infection and Reduces Virus Growth through Protein ISGylation. Gonzalez-Sanz R, Mata M, Bermejo-Martin J, Alvarez A, Cortijo J, Melero JA, Martinez I. J Virol. 2016 Jan 13;90(7):3428-38. doi: 10.1128/JVI.02695-15. 10.1128/JVI.02695-15 PubMed 26763998