Skip to main content

RTB300
(Plasmid #80410)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80410 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Bluescript KS+
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TNNT2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4300
  • Entrez Gene
    TNNT2 (a.k.a. CMD1D, CMH2, CMPD2, LVNC6, RCM3, TnTC, cTnT)
  • Promoter RSV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CATTCACCACATTGGTGTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RTB300 was a gift from Thomas Cooper (Addgene plasmid # 80410 ; http://n2t.net/addgene:80410 ; RRID:Addgene_80410)
  • For your References section:

    Disruption of splicing regulated by a CUG-binding protein in myotonic dystrophy. Philips AV, Timchenko LT, Cooper TA. Science. 1998 May 1;280(5364):737-41. PubMed 9563950