RTB300
(Plasmid
#80410)
-
Purposehuman cTNT minigene with genomic segment containing alternative exon 5
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80410 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBluescript KS+
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTNNT2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4300
-
Entrez GeneTNNT2 (a.k.a. CMD1D, CMH2, CMPD2, LVNC6, RCM3, TnTC, cTnT)
- Promoter RSV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CATTCACCACATTGGTGTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RTB300 was a gift from Thomas Cooper (Addgene plasmid # 80410 ; http://n2t.net/addgene:80410 ; RRID:Addgene_80410) -
For your References section:
Disruption of splicing regulated by a CUG-binding protein in myotonic dystrophy. Philips AV, Timchenko LT, Cooper TA. Science. 1998 May 1;280(5364):737-41. PubMed 9563950