-
PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-EGFP for RNA targeting
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109049 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelenti(AMP)
- Total vector size (bp) 12990
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCasRx
-
Alt nameNLS-RfxCas13d-NLS
-
SpeciesH. sapiens (human); Ruminococcus flavefaciens XPD3002
-
Insert Size (bp)3000
- Promoter EF1A
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- HA (C terminal on insert)
- 2A-eGFP (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggatcttggttcattctcaagcctc
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid may undergo recombination. Addgene recommends screening at least 3-6 colonies upon receipt.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXR001: EF1a-CasRx-2A-EGFP was a gift from Patrick Hsu (Addgene plasmid # 109049 ; http://n2t.net/addgene:109049 ; RRID:Addgene_109049) -
For your References section:
Transcriptome Engineering with RNA-Targeting Type VI-D CRISPR Effectors. Konermann S, Lotfy P, Brideau NJ, Oki J, Shokhirev MN, Hsu PD. Cell. 2018 Mar 8. pii: S0092-8674(18)30207-1. doi: 10.1016/j.cell.2018.02.033. 10.1016/j.cell.2018.02.033 PubMed 29551272